l3ilki6nsluciejeavon l3ilki6nsluciejeavon

23-02-2017
Mathematics

Answered

Mrs.tokalaka uses 9/10 of a can of coffe beans,each week.how many cans of beans does she use in 6 weeks? write your answer two different ways

Verified Answer :

rinadreams rinadreams

23-02-2017

9 x 6 = 54

so you can write it as
54/60
or = 22/30
= 11/15

Answer Link

Related Questions

Which of the following is an abiotic factor of a desert a cactus b sand c lizards d wildflowers

what is the difference between tambos and

Part 1 CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks 3

Under the Eighth Amendment a person charged with a crime A has the option of hiring a lawyer B has to pay 20 to a jury C does not have to pay excessive bail D d

In what way did Congress continue the work of the Constitutional Convention What gaps in the Constitution did Congress fill

Can someone help me finish answering this prompt Im almost done How do the organs and systems of an animal facilitate the creatures carrying out each of the cha

Some students attend school 180 of the 365 days in a year About what part of the year do they attend school

George decides to ride the worlds tallest Ferris wheel the High Roller Ferris Wheel in Las Vegas This Ferris wheel has a diameter of 520 feet When George gets i

ten times the sum of half a number and 6 is 8

Most intraplate volcanic activity occurs where a mantle plumes rise toward the surface within a plate b oceanic plates diverge c hot magma descends into the man

Web Analytics