hdiaz931 hdiaz931

21-02-2017
Biology

Answered

Part 1: CCATAGCACGTTACAACGTGAAGGTAA

Convert it into RNA

List Amino Acids and do the same with

CCGTAGCATGTTACAACGCGAAGGCAC

thanks :3

Verified Answer :

dana1321 dana1321

22-02-2017

RNA--GGUAUCGUGCAAUGUUGCACUUCCAUU

Answer Link

Related Questions

Rewrite the following number in scientific notation 2301000000

Which statement best describes Andrew Jacksons twoterm presidencyAJackson was a grim rough and often difficult president who used the power of the executivebran

Is 200 a whole number and a natural number

There are 22 different amino acids What part of each amino acid is different from the others

Valence is the number of electrons an atom must gain or lose in order to its outer shell or have a stable octet in its outer shell

Allison wants to cut out a rectangle with an area of 54 inches She has one piece of paper measuring 9 by 12 inches How many rectangles can she cut out from the

which word comes from a latin word meaning lattice

According to the Declaration of Independence in which ways did the king deny the colonists Life Liberty and the pursuit of Happiness

Whats a good topic sentence for a essay about concentration camps in World War 2

The atrisk limitation provisions of the Internal Revenue Code may limit I A partners deduction for his or her distributive share of partnership lossesII A partn

Web Analytics