euriah123 euriah123

31-01-2017
Chemistry

Answered

Which statement is most true about a hypothesis?

It is a conclusion drawn in an investigation.

It is an observation that you make.

It is a trend observed in data.

It is a testable solution to a question.

Verified Answer :

sciencific sciencific

31-01-2017

This is from dictionary: a supposition or proposed explanation made on the basis of limited evidence as a starting point for further investigation.
I would say it is 2

Answer Link

Related Questions

An appliance store sells 100 microwaves in the month of April If it sells 115 more microwaves in the next month how many microwaves does it sell in May a 105 b

you invest 1500 today in a bank that gives you a 5 percent annual interest rate which of these items can you buy in two years

Which is a physical contaminant? A. Mold on cheese B. Peanuts on a sundae C. Salmonella typhi in poultry D. Twist tie in a tossed salad

When looking back at stock sells done in the heat of the moment most investors think a They should have waited longer b They made the right decision c Emotions

A grocer stacks oranges in a foursided pyramid that is 6 layers high Solve for the number of oranges in the pile A 36 B 546 C 105 D 91

You want to rent a limousine for a trip to the city The limo costs 700 for the night and 015 per mile You have 750 to spend Write an inequality that represents

How would you define evolution

Part 1 CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks 3

A movie theater went through 3 pounds of popcorn every 4 hoursThey went through of a pound every hour fill in the blank

Web Analytics