radomes.openskiesproject.org
Vmattio
Vmattio Vmattio
  • 29-08-2016
  • Mathematics
Answered

The prism below is made of cubes which measure 1/4 of an inch on one side. What is volume

Verified Answer :

MillerR
MillerR MillerR
  • 29-08-2016

Volume of cube=side length cubed

1/4^3=0.015625in^3

Answer Link

Related Questions

How has call center companies addressed the issues of diversity and inclusion in the workplace
Which transformation could have been applied to the door Explain your answer
Common law is a term for law that is common throughout the world a True b False
opposite reciprocal slope lines or parallel or perpendicular
literal equation RR1R2 for R2
Part 1 CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks 3
Consider the balanced equation. $N_2+3 H_2 \rightarrow 2 NH_3$ What is the mole ratio of hydrogen to ammonia? A. 1 : 1 B. 1 : 2 C. 3 : 2 D. 5 : 4
Find the leg of each isosceles right triangle when the hypotenuse is of the given measure Given 8 cm
How can biologists help meet the needs of people who live in hot dry environments
When point ADEF was dilated point D 153 became Point D 51 Wht is the scale factor used in dilation