What are the three types of regions

Question

23-02-2016
Biology

Answered

What are the three types of regions

Verified Answer :

Related Questions

Select the main characteristics of a ballad action is swift centered around one scene five lines of poetry clever and funny couplet told in simple language deal

9 stores is 3 of stores

Part 1 CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks 3

I dont seem to understand this problem may you guys help me

A disadvantage of using a sentence outline instead of a topic outline is that a sentence outline is often A underdeveloped B factually grounded C rigid D timeco

Whoever answers this I LOVE YOU 15 points plz Also dont just put 1 answer LOV U

Which of the following was NOT an important component of the American System

Wearing and properly using safety equipment reduces the risk of injury during physical activitywearing and properly using safety equipment reduces the risk of i

Which of the following countries was NOT an Axis power AJapan BGermany CPortugal DItaly

dahamivherath dahamivherath · Answer 1 · 2016-02-23T15:11:27-05:00

dahamivherath dahamivherath

23-02-2016

the three types of regions are formal,functional and vernacular.

formal region-regions defined formally, often by government or other structures.
functional region-made up of a central place and surrounded places affected by it
vernacular-a region that people belive exists as part of their identity.

hope this helps...........

Answer Link