radomes.openskiesproject.org
nickhadley nickhadley
  • 05-11-2015
  • Mathematics
Answered

Two numbers are w and 3w - 5. Their sum is 23. Solve the equation w + 3w -5 = 23 to find the numbers.

Verified Answer :

davidyangnyc
davidyangnyc davidyangnyc
  • 05-11-2015

4x-5=23
4x=28
x=7
w=7
3x-5=3(7)-5=21-5=24

Answer Link
InkS
InkS InkS
  • 05-11-2015

w + 3w - 5 = 23
+5 +5 (-5 +5 cancels out and equals 0)
Like terms. What you do to one side, you do to the other.
4w = 28
---- ---
4 4
Isolate w by dividing by 4
W = 7

Answer Link

Related Questions

Widely used in europe but controversial in the united states programs suggest that moderate substance use can be a successful treatment outcome
in 80 blocks 20 blocks are shaded what us the percentage and why
what is 194 as a mixed number
explain it How can you use a right angle to determine the classification of another angle
63512 to the nearest thousand
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene 3TAAACTGTACAGGGCCATAACT5
What part does private industry play in fighting this epidemic
Which of the following does not accurately depict a scientific theory
Where did the Maya establish villages I only need the answer 1 sentence long thanks
The theme of this passage from the Declaration of Independence is best described as 5 points connections and correspondence were interrupted many attempts were