Anonymous Anonymous

23-09-2015
Mathematics

Answered

jasmine drank 2 pints of milk each day,and Brenda drank 3 pint each day. if one pint of milk is equivalent to 2 cups of milk , how many cups did jasmine and brenda each drink?

Verified Answer :

23-09-2015

2 x 2 = 4 Jasime drank 4.

3 x 2 = 6 Brenda drank 6.

Answer Link

Related Questions

which two elements should be included with each visual aid in a technical document

What are the means of the following proportion 315 1260 A 12 and 60 B 3 and 60 C 3 and 15 D 15 and 12

In order to infer a theme from a story one must identify the central and its conflict resolution motif moral character traits author persona

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene 3TAAACTGTACAGGGCCATAACT5

what is 96 in simplest form

You are a world famous scientist who has discovered the gene that codes for a specific protein used to dissolve blood clots in humans You are about to mass prod

is PATRICIA BATH STILL ALIVE IN 2015

this is my problem could you help answer it

According to the article addictions to certainbehaviors occur when O A people have no other options to pass thetimeO B people repeatedly ignore signs that theya

What is the solution to y37x 1

Web Analytics