KingUnitess789 KingUnitess789

08-02-2017
Geography

Answered

Coastal areas that are near warm ocean currents are more likely to experience which of following effects?

lower tides

higher tides

warmer weather

colder weather

Verified Answer :

Anonymous Anonymous

08-02-2017

B.) Coastal areas that are near warm ocean currents are more likely to experience "Higher Tides"

Hope this helps!

Answer Link

12-10-2020

Answer's B. Hope it helps!

Answer Link

Related Questions

In the 1700s an effect of the Enlightenment was

The graph shows the distance y in miles of a moving motorboat from an island for a certain amount of time x in hours What is the speed of the motorboat 35miles

Cladodes are modified stems Which is their main function Water retention Food storage Photosynthesis

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene 3TAAACTGTACAGGGCCATAACT5

I need help with 940

What is the length of Line BC A 9 units B 11 units C 15 units D 16 units

Kelsey is formatting a 30page proposal and wants to make it easier for thereader to navigate the sections What can she add in the document to achievethisA Hyper

When the fundraiser began 600 people wanted to purchase the dance troupes Tshirts at 12 per Tshirt but as the group increased the price of their Tshirts they no

how to turn 165 percent into a fraction

Which phrase reveals setting in songmaster by orson scott card

Web Analytics