Anonymous Anonymous

07-02-2017
Mathematics

Answered

Could someone help with proportions?

Could someone help with proportions? class=

Verified Answer :

jaidymae10 jaidymae10

07-02-2017

n 5
____ = ____
50 25

What you do is cross multiply. You do that by multiplying 25 and n and 50 and 5

25n=250

Then you divide by the variable

25n=250
________

25n 25n
n=10

The answer is n=10

Answer Link

Related Questions

Which sentences describe the characteristics of a corporation AThe company is treated as a separate tax entity by law BThe owners have to accept partial liabili

Enter two fractions that are greater than 14 and less than 1

In the gene TATTCATTGTTATGATTTATTCG CATTGTTA encodes for pepsin a digestive enzyme The rest of the sequence doesnt code for any protein Which sequence contains

Why did the Boston massacre happened

A patient reports severe headaches and chronic tingling in their arms and legs To which of the following specialties should the provider refer thepatient for a

Even while Britain had established a parliamentary government what people made up the oligarchy that really ruled it

In Casabianca the boys defining character trait is his ingenuity sense of humor foolishness loyalty

When the ideal gas law is arranged as shown below what property of the gas is being solved for represented by the X x equals nRT over V Moles Pressure Temperatu

was the more effective policy in reducing the risk for injury and fatality in the early childhood setting according to a recent study a Requiring teachers to h

The ability to read quickly effortlessly and efficiently with good meaningfula Accuracyb Fluencyc Phrasingd ChunkingPlease select the best answer from the choic

Web Analytics