agamagda agamagda

02-02-2017
Mathematics

Answered

Find the difference 6-3 2/5

Verified Answer :

Xander4D Xander4D

02-02-2017

Question 6 - 3 2/5 = 2 3/5

Answer Link

Related Questions

Raise the Driving Age to 18 After reading Mr J Browns letter dated August 15 I feel compelled to write and let your readers know how I feel about raising the dr

Javier wants to improve his flexibility and increase his personal discipline which community resource should he select Tennis Lessons Soccer League Swim Club ka

if a triangle has 44mm28mm24mm angles 1104030 what type of triangle is it

It was a test Zeitoun thinks Who among us could deny that we were tested But now look at us he says Every person is stronger now Every person who was forgotten

In the context of a résumé which of the following statements most effectively features the skill being described A Reprogrammed operating systems B Programming

Which math expression represents the phrase 9 times the sum of a number and 7 A 9 n 7 B 9 n 7 C 9 n 7 D 9 n 7

Hiroto paid 428 in sales tax for the items that he purchased If the sales tax rate was 625 percent what was the total cost of the items before tax was added

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene 3TAAACTGTACAGGGCCATAACT5

Describe the movement of a floating object on a pond when struck by a wave

Modelling ProblemsolvingThis bathtub is filled from a tap witha flow rate of 18 litres per minuteModel the bathtub as a cuboidand estimate the length of timeit

Web Analytics