aliana0227 aliana0227

26-08-2016
History

Answered

if you were to walk south from the western USA, What country would you enter????

Verified Answer :

26-08-2016

It has to be mexico, its the only country west AND south of the USA.
Hope this helped

Answer Link

Related Questions

evaluate tex int limits52 x2 3x dx tex

In which sentence is race used as a noun A Tom won the race B Tom will race with four other boys C If you race across town youll be on time D Dont race the moto

A triangular bandana has an area of 70 square inches The height of the triangle is 8 34 inches Write and solve an equation to find the length of the base of the

what is 894 rounded to the nearest tenth

HELP MEHELP MEOn a piece of paper use a protractor to construct a triangle with angle measures of 20 and 30 Select from the dropdown menu to correctly classify

Which of the following is not true of carbon dioxide

SOme people might argue that an orange is a high level food Others would disagree and consider a cup pf pasta to be a high energy food How is it possible for bo

Please Help Me I need to know why its the answers you picked

What is the mRNA sequence to match the DNA sequence below TACGCTCCATATCGCTAATCGCCGGATCAGATT

Each radio station broadcasts on a specific frequency called a carrier wave Please select the best answer from the choices provided

Web Analytics