Which equation illustrates the additive inverse property?

A-3 + 3 = 3 + (-3)
B3 x 0 = 0
C(3 + 0) + 1 = 3 + (0 + 1)
D-3 + 3 = 0

Question

26-07-2016
Mathematics

Answered

Which equation illustrates the additive inverse property?

A-3 + 3 = 3 + (-3)
B3 x 0 = 0
C(3 + 0) + 1 = 3 + (0 + 1)
D-3 + 3 = 0

Verified Answer :

Related Questions

Why is it important to eat foods each day from each of the five food groups No food or food group can supply the body with all the essential nutrients needed fo

In the diastole phase of the cardiac cycle which is the correct direction of the flow of blood From the right ventricle to the pulmonary artery via the pulmonar

What is the mRNA sequence to match the DNA sequence below TACGCTCCATATCGCTAATCGCCGGATCAGATT

what led to the rise of the merchant

Who should the medical assistant consult prior to making a social engagement with a patient? A. The AMA B. The employer C. Your lawyer D. Your friend

Which president didnt have a Vice President

I will never learn to juggle your friend says one afternoon She keeps dropping the items every time she tries to throw them in the air Sure you will you tell he

Need 2 PEE paragraphs on dose school kill our creativity Pls I need help

Kings protest were not peaceful True or False

nobillionaireNobley nobillionaireNobley · Answer 1 · 2016-07-30T02:48:12-04:00

nobillionaireNobley nobillionaireNobley

30-07-2016

The additive inverse of a positive number is the negative of that number and vice-versa
Therefore, -3 + 3 = 3 + (-3) illustrates additive inverse property.

Answer Link

Which equation illustrates the additive inverse property? A-3 + 3 = 3 + (-3) B3 x 0 = 0 C(3 + 0) + 1 = 3 + (0 + 1) D-3 + 3 = 0

Verified Answer :

Related Questions

Which equation illustrates the additive inverse property?

A-3 + 3 = 3 + (-3)
B3 x 0 = 0
C(3 + 0) + 1 = 3 + (0 + 1)
D-3 + 3 = 0