radomes.openskiesproject.org
mari5505 mari5505
  • 06-03-2016
  • Chemistry
Answered

why dose the moon change shape

Verified Answer :

Anonymous Anonymous
  • 06-03-2016

The earth's rotation.

Answer Link
Anonymous Anonymous
  • 08-03-2016

The shape of the moon does not change as much. The shape of sunlight reflects off of the moon then it appears to change the relative positions of the Earth, the moon and also the sun and the moon's orbit is around the Earth.

Answer Link

Related Questions

The question is At the pet fair there were42 dogs and 35 cats The pets must be split into small groups so that there are the same number of dogs in each group a
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
As a good rule of thumb a person should rehearse their entire presentation at least times
Why are modern homes more likely to have higher indoor pollution A They use kerosene heaters B They use asbestos to prevent fires C They have central heating an
What impact did the Magna Carta have on the English monarchy
what happens to the ratio when an excess quantity of a reactant exists
A person must be 21 to buy male condoms True or False
A map of Brunswick County has a scale of 15 inches 5 mile If the actual Distance from Lawrenceville to Brodnax is 10 miles what is the distance on the map
what would happen to the population of an animal if its natural predator was removed from the food web AIt would decrease BIt would stay the same Cit would incr
What is 5 of 200 need help now