katherine0518 katherine0518

31-05-2024
Mathematics

Answered

45,17,39,1,4,16 medían, q1,q2, and iqr

Verified Answer :

Related Questions

How did Sylvia Mendez help expand civil rights A She supported samesex marriage by participating in the reading of a play B She formed Asian Americans for Equal

how did the middle passage affect enslaved africans

What is a system of beliefs within a religion that is regarded as being extreme and may give rise to terrorism

The energy consumption of an appliance is measured in kilowatthours and is the product of the kilowatts per hour the appliance uses and the number of hours it u

Match the definition to the correct ecological levelくIndividualgt1Biosphere2EcosystemBiomeOne organismA group of organisms of the samespecies in the same area3

2126 only please help quickly I need answer quickly

Create an analogy for the relationship between photosynthesis and cellular respiration

Money allows and producers to connect with each other much more than bartering

In the gene TATTCATTGTTATGATTTATTCG CATTGTTA encodes for pepsin a digestive enzyme The rest of the sequence doesnt code for any protein Which sequence contains

Which description of Francis Lowell is correct A He made slavery profitable in the South by inventing a simple machine that removed seeds from cotton B He paten

Web Analytics